View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19603_high_7 (Length: 361)
Name: NF19603_high_7
Description: NF19603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19603_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 309; Significance: 1e-174; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 1 - 322
Target Start/End: Complemental strand, 55381284 - 55380961
Alignment:
| Q |
1 |
aagcaaacatcatgaatatttttccagaactccatcatccggttattatgacaaaaccagaccagtaccgtccactagtggaaaaaacacattccacaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55381284 |
aagcaaacatcatgaatatttttccagaactccatcatccggttattatgacgaaaccagaccagtaccgtccactagtggaaaaaacacattccacaat |
55381185 |
T |
|
| Q |
101 |
gagctttcacagcagagattcgctgctt--ccacacaatgcaacaatgcggtgagggagtcacgtatgctcacgagtcagccgccgctgatcgttcactt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55381184 |
gagctttcacagcagagattcgctgctttgccacacaatgcaacaatgcggtgagggagtcacgtatgctcacgagtcagccgccgctgatcgttcactt |
55381085 |
T |
|
| Q |
199 |
acgccatcatgtcatttgccatcctggctcttgcttcactacataccctcactcttcctccgtttgtcgccgacatgtcacactcaccagaataaggttg |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55381084 |
acgccatcatgtcatttgccatcctggctcttgcttcactacataccctcactcttcctccgtttgtcgccgacatgtcacactcaccagaataaggttg |
55380985 |
T |
|
| Q |
299 |
gtatatttatttggattttctatc |
322 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
55380984 |
gtatatttatttggattttctatc |
55380961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 333 - 361
Target Start/End: Complemental strand, 55380949 - 55380921
Alignment:
| Q |
333 |
ccttctaaatatgcaatgtctagtgttct |
361 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
55380949 |
ccttctaaatatgcaatgtctagtgttct |
55380921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University