View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19603_low_11 (Length: 315)
Name: NF19603_low_11
Description: NF19603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19603_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 19 - 271
Target Start/End: Complemental strand, 37745092 - 37744839
Alignment:
| Q |
19 |
tatttgttgagttttgtgggttcattggaaggggtattggtggagatggaggattttacggatatgcgccgagagggagtgggggtgtgagtaggaaaga |
118 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37745092 |
tatttgttaagttttgtgggttcaatggaagggggattggtggagatggaggattttacggatatgcgccgagagggagtgggggtgtgagtaggaaaga |
37744993 |
T |
 |
| Q |
119 |
gggcgttgtaggttggggaaaagagagttgactgcattgttacggcggaggagtgtggaatggtgagggttttggagtgggcgcgg-aaatgggtttagg |
217 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37744992 |
gggcggtgtaggttggggaaaagagagttgactgcattgttacggcggaggagtgtggaatggagagggttttggagtgggcgcggaaaatgggtttagg |
37744893 |
T |
 |
| Q |
218 |
aatgagtagtaagggagtgttgtaggaaggagagtgactaatttctcatatcgc |
271 |
Q |
| |
|
|| |||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37744892 |
aaggagtagtaagtgagtgttgtaggaaggagagtgactaatttctcatatcgc |
37744839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University