View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19603_low_16 (Length: 265)
Name: NF19603_low_16
Description: NF19603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19603_low_16 |
 | |
|
| [»] scaffold0450 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0450 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: scaffold0450
Description:
Target: scaffold0450; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 10380 - 10121
Alignment:
| Q |
1 |
atcttttcgataatgacattaccttctcaaggggttgcacatcttgatagaaattaaagaggtcggaattcagaagtccacttgcatcattgttctcatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
10380 |
atcttttcgataatgacattaccttctcaaggggttgcacatcttgatagaaattaaagaggtcagaattcagaagaagacttgcatcattgttctcatt |
10281 |
T |
|
| Q |
101 |
catctgattcaagacaaaaaatatgtcagtaacattaaaaataatttttggtgcgcgcacattacgtgtgtgtctatataccaa--------atattgtt |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
10280 |
catctgattcaagacaaaaaatatgtcagtaacattaaaaataatttatggtgcgcgcacattacatgtgtgtctatataccaaatgtttctatattgtt |
10181 |
T |
|
| Q |
193 |
tgcagacctcattgatggaattagcattcttatggtgttcctcattttcaacagcagcct |
252 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10180 |
tgcatacctcattgatggaattagcattcttatggtgttcctcattttcaacagcagcct |
10121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University