View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19603_low_17 (Length: 254)
Name: NF19603_low_17
Description: NF19603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19603_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 8 - 236
Target Start/End: Original strand, 11576203 - 11576431
Alignment:
| Q |
8 |
ccaagaatatgtttacttttaaagtttattagagttatcttgtttcaataatttaatctcttggtctatgaaacaacaaccaacattatcttaatctaat |
107 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| || | |||||||||||||||||||||||||||||| |
|
|
| T |
11576203 |
ccaacaataagtttacttttaaagtttattagagttatcttgtttggataatttaatctcttgggctgtcaaacaacaaccaacattatcttaatctaat |
11576302 |
T |
 |
| Q |
108 |
atcgaagccaaacacggtggtgtcactaatgtagttttcgagtcttgttgacttcaaaacttaattttgaagctttttcatttttagttttaccctttgt |
207 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11576303 |
atcgaagccaaacaccgtggtgtcactaatgtagttttcgagtcttgttgacttcaaaacttaattttgaagctttttcatttttagttttaccctttgt |
11576402 |
T |
 |
| Q |
208 |
tcaagttgacttagaaaataataaaacgt |
236 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11576403 |
tcaagttgacttagaaaataataaaacgt |
11576431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University