View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19603_low_22 (Length: 248)
Name: NF19603_low_22
Description: NF19603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19603_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 14166230 - 14166013
Alignment:
| Q |
1 |
tgttggatgtggttttagtttttctttcattatgagaacttaaaagtactattttattatatggttgatggtatgtttgatggttcattttgacttgaaa |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14166230 |
tgttgaatgtggttttagtttttctttcattatgagaacttaaaagt----------tatatagttgatggtatgtttgatggttcattttgacttgaaa |
14166141 |
T |
|
| Q |
101 |
actttatttgaagtttcaaacattatcaataatacatgatgaacaagctcaaaaataaaacaatttcgtagaaatgttaattgttagattaagattaagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
14166140 |
actttatttgaagtttcaaacattatcaataatacatgatgaacaagctcaaaaataaaacaatgtcgtagacatgttaattgttaga-taagattaagg |
14166042 |
T |
|
| Q |
201 |
atttcgtgctctgtcaaatttcagaatat |
229 |
Q |
| |
|
|||||||||||||| |||||| ||||||| |
|
|
| T |
14166041 |
atttcgtgctctgttaaattttagaatat |
14166013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University