View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19603_low_27 (Length: 221)
Name: NF19603_low_27
Description: NF19603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19603_low_27 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 43 - 212
Target Start/End: Complemental strand, 24212204 - 24212035
Alignment:
| Q |
43 |
ctgtccacattgcaccaatgcaatgtaagaaagtaagaggaccgaaaagtttgttgtgccattactatggttttatttttgtgaacaaatgaaaaacgtg |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24212204 |
ctgtccacattgcaccaatgcaatgtaagaaagtaagaggaccgaaaagtttgttgtgccattactatggttttatttttgtgaacaaatgaaaaacgtg |
24212105 |
T |
 |
| Q |
143 |
acattcttattgtgttttgttttcttagacttttctttatacagtttttggattttgatgatgatgatgt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24212104 |
acattcttattgtgttttgttttcttagacttttctttatacagtttttggattttgatgatgatgatgt |
24212035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 82 - 191
Target Start/End: Complemental strand, 24208425 - 24208317
Alignment:
| Q |
82 |
gaccgaaaagtttgttgtgccattactatggttttatttttgtgaacaaatgaaaaacgtgacattcttattgtgttttgttttcttagacttttcttta |
181 |
Q |
| |
|
||||||||||||||||||| ||||| | || | ||||||||||||||||| | |||||||| |||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
24208425 |
gaccgaaaagtttgttgtgacatta-tgtgctcttatttttgtgaacaaaaggaaaacgtgtcattattattgtgttttgtttttgtagacttttcttta |
24208327 |
T |
 |
| Q |
182 |
tacagttttt |
191 |
Q |
| |
|
| | |||||| |
|
|
| T |
24208326 |
ttcggttttt |
24208317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University