View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19603_low_30 (Length: 202)
Name: NF19603_low_30
Description: NF19603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19603_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 13 - 186
Target Start/End: Complemental strand, 3151063 - 3150887
Alignment:
| Q |
13 |
ataattctcaagctaactttgtcaacttgttcaacggatcgagtttcaatggcagccatagta---tagcaaaagagaggacaaaaacacacagatatgc |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
3151063 |
ataattctcaagctaactttgtcaacttgttcaacggattgagtttcaatggcagccatagtagtatagcaaaagagaggacaaaaacacagagatatgc |
3150964 |
T |
|
| Q |
110 |
taacacaactatccaaaatgtgcttataaagagtatttttaaattgacgcttccttttttctataactagtggacat |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3150963 |
taacacaactatccaaaatgtgcttataaagagtatttttaaattgacgcttccttttttctataactagtggacat |
3150887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 21 - 71
Target Start/End: Original strand, 3495028 - 3495078
Alignment:
| Q |
21 |
caagctaactttgtcaacttgttcaacggatcgagtttcaatggcagccat |
71 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||||| |||||||| |
|
|
| T |
3495028 |
caagctaactttgtcaacttgttcaactgattgagtttcaattgcagccat |
3495078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University