View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19604_high_16 (Length: 247)
Name: NF19604_high_16
Description: NF19604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19604_high_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 12 - 214
Target Start/End: Original strand, 33926174 - 33926376
Alignment:
| Q |
12 |
aaatatattcaatgtaagttatgttattcaaggagcttaatcaaacgtttattacaagttaaactagtttataaacttattttcatgtttgtctcatatc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33926174 |
aaatatattcaatgtaagttatgttattcaaggagcttaatcaaacgtttattacaagttaaactagtttataaacttattttcatgtttgtctcatatc |
33926273 |
T |
 |
| Q |
112 |
cggcatatctaatcaaggtgtgtctggtgtccgacaagtgttagtattcgacactgacacatgcgattacgtttgattaattcattttctcaaaatataa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33926274 |
cggcatatctaatcaaggtgtgtctggtgtccgacaagtgttagtattcgacactgacacatgcgattacgtttgattaattcattttctcacaatataa |
33926373 |
T |
 |
| Q |
212 |
tcg |
214 |
Q |
| |
|
||| |
|
|
| T |
33926374 |
tcg |
33926376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 163 - 205
Target Start/End: Original strand, 10764079 - 10764121
Alignment:
| Q |
163 |
cactgacacatgcgattacgtttgattaattcattttctcaaa |
205 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
10764079 |
cactgacacatgcgattacgttcaattaattcattttttcaaa |
10764121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University