View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19606_high_10 (Length: 232)
Name: NF19606_high_10
Description: NF19606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19606_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 135 - 208
Target Start/End: Complemental strand, 21087075 - 21087002
Alignment:
| Q |
135 |
gacttcgaggatatttgaacgatatcttttaaagttacaatgtcaaacttatcttattattgaaattgcgcctc |
208 |
Q |
| |
|
|||||| ||||||||| |||||||||| |||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
21087075 |
gacttcaaggatatttcaacgatatctcttaaagttacaatgtcaaacttatcttaatattgaaattgtgcctc |
21087002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 15 - 64
Target Start/End: Complemental strand, 21087195 - 21087146
Alignment:
| Q |
15 |
aaaataatttcatttttgtatactttaatatcaccagtatatcgtgtttg |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21087195 |
aaaataatttcatttttgtatactttaatatcaccagtatatcgtgtttg |
21087146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University