View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19606_high_8 (Length: 248)
Name: NF19606_high_8
Description: NF19606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19606_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 96 - 161
Target Start/End: Complemental strand, 36930317 - 36930252
Alignment:
| Q |
96 |
cgaattgattttcaccattaattctgcaattaatacaataaatggatggacaggatacaaggtgat |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36930317 |
cgaattgattttcaccattaattctgcaattaatacaataaatggatggacaggatacaaggtgat |
36930252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 164 - 199
Target Start/End: Complemental strand, 36930217 - 36930182
Alignment:
| Q |
164 |
atgtcgggaacacatctctcgggacaaatagcatta |
199 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36930217 |
atgtcgggaacacatctcttgggacaaatagcatta |
36930182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 158 - 199
Target Start/End: Complemental strand, 12504409 - 12504368
Alignment:
| Q |
158 |
tgatatatgtcgggaacacatctctcgggacaaatagcatta |
199 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12504409 |
tgatatatgtcgggaacacatctcttgggacaaatagcatta |
12504368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University