View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19606_high_8 (Length: 248)

Name: NF19606_high_8
Description: NF19606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19606_high_8
NF19606_high_8
[»] chr5 (2 HSPs)
chr5 (96-161)||(36930252-36930317)
chr5 (164-199)||(36930182-36930217)
[»] chr1 (1 HSPs)
chr1 (158-199)||(12504368-12504409)


Alignment Details
Target: chr5 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 96 - 161
Target Start/End: Complemental strand, 36930317 - 36930252
Alignment:
96 cgaattgattttcaccattaattctgcaattaatacaataaatggatggacaggatacaaggtgat 161  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36930317 cgaattgattttcaccattaattctgcaattaatacaataaatggatggacaggatacaaggtgat 36930252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 164 - 199
Target Start/End: Complemental strand, 36930217 - 36930182
Alignment:
164 atgtcgggaacacatctctcgggacaaatagcatta 199  Q
    ||||||||||||||||||| ||||||||||||||||    
36930217 atgtcgggaacacatctcttgggacaaatagcatta 36930182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 158 - 199
Target Start/End: Complemental strand, 12504409 - 12504368
Alignment:
158 tgatatatgtcgggaacacatctctcgggacaaatagcatta 199  Q
    ||||||||||||||||||||||||| ||||||||||||||||    
12504409 tgatatatgtcgggaacacatctcttgggacaaatagcatta 12504368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University