View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19606_high_9 (Length: 239)
Name: NF19606_high_9
Description: NF19606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19606_high_9 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 239
Target Start/End: Complemental strand, 1150317 - 1150095
Alignment:
| Q |
18 |
cttgcaattagacaccatcttggatgtaaagttcaactatcctgtaaaagtaaaaattttgagatagttgaagattaaaaaa-tagaagttttaaggatt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1150317 |
cttgcaattagacaccatcttggatgtaaagttcaactatcctgtaaaagtgaaaaatttgagatagttgaagattaaaaaaatagaagttttaaggatt |
1150218 |
T |
 |
| Q |
117 |
tcgagtaatcgaatgaaaagaaggcaatatatatacatgcattatgtaacaaactcatagttcaattagttaccatgtgaaccgatatgaatgggtttct |
216 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1150217 |
ttgagtaatcgaatgaaaagaaggcaatatatatacatgcattatgtaacaaactcatagttcaattagttaccatgtgaaccgatatgaatgggtttct |
1150118 |
T |
 |
| Q |
217 |
ttggaagataagattttcatttt |
239 |
Q |
| |
|
||||||||||| ||||||||||| |
|
|
| T |
1150117 |
ttggaagataaaattttcatttt |
1150095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 153 - 211
Target Start/End: Original strand, 8409857 - 8409915
Alignment:
| Q |
153 |
atgcattatgtaacaaactcatagttcaattagttaccatgtgaaccgatatgaatggg |
211 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||||||||| |||||||| ||||| |
|
|
| T |
8409857 |
atgcattatgtaacaaactcatagtgcacttagttaccatgtgatccgatatgtatggg |
8409915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University