View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19606_low_8 (Length: 258)
Name: NF19606_low_8
Description: NF19606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19606_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 20 - 256
Target Start/End: Original strand, 8896936 - 8897172
Alignment:
| Q |
20 |
aattactatgactatagcgcctaccatcactagaagttcttgaattcttagtaaccgcatttgaaataacctctccaacattgccacaactattaatatg |
119 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
8896936 |
aattactatgattatagcgcctaccatcactagaagttcttgaattcttagtaaccgcatttgaaatagcctctccaacattgccacgactattaatatg |
8897035 |
T |
|
| Q |
120 |
atttgaagcatgacaaaagtcattgccaaaaccctgaccagcactaggagaatcatgcactgcatgatccaaatcagnnnnnnnagcaaggttttggttg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
8897036 |
atttgaagcatgacaaaagtcattgccaaaaccctgaccagcactaggagaatcatgcactgcatgatccaaatcagttttttcagtaaggttttggttg |
8897135 |
T |
|
| Q |
220 |
tgaaaactgtagttagcgtcataacagcaattatgat |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8897136 |
tgaaaactgtagttagcgtcataacagcaattatgat |
8897172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University