View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19606_low_9 (Length: 257)
Name: NF19606_low_9
Description: NF19606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19606_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 114; Significance: 7e-58; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 7 - 149
Target Start/End: Complemental strand, 31816949 - 31816807
Alignment:
| Q |
7 |
tccaagaatattagaacaatacaaagatgatcaactttggccctattcactattgcttcaattttggtgggattcattagatctgaagctaatagagatc |
106 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31816949 |
tccaataaaattagaacaatacaaagatgatcaactttggccctattcactattgcttcaattttggtgggattcattagatctgaagctaatagagatc |
31816850 |
T |
|
| Q |
107 |
atacatgnnnnnnncaagggaccaaataggttattgaatactt |
149 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31816849 |
atacatgtttttttcaagggaccaaataggttattgaatactt |
31816807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 215 - 257
Target Start/End: Complemental strand, 31816811 - 31816769
Alignment:
| Q |
215 |
tacttaatttaattttgtatgattgtgcttcatatattgggaa |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31816811 |
tacttaatttaattttgtatgattgtgcttcatatattgggaa |
31816769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University