View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19607_high_4 (Length: 314)
Name: NF19607_high_4
Description: NF19607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19607_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 1 - 303
Target Start/End: Complemental strand, 54854716 - 54854414
Alignment:
| Q |
1 |
catctcacatttacaatacctgccatgaaaattttgagcaataaacaacaatacattagccagaatccagataaagatccattgttgaggcgcagcactc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54854716 |
catctcacatttacaatacctgccatgaaaattttgagcaatgaacaacaatacattagccagaatccagataaagatccattgttgaggcgcagcactc |
54854617 |
T |
|
| Q |
101 |
tagtcctcatccaaatcaggtttacagcagagctgaactgaggataaggatggtggaatcaaccaatcaaaatgcatcaatcataacataatccaaggcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54854616 |
tagtcctcatccaaatcaggtttacagcggagctgaactgaggataaggatgatggaatcaaccaatcaaaatgcatcaatcataacataatccaaggcc |
54854517 |
T |
|
| Q |
201 |
caaaactactataaataaggggctaacccccggtttaatcactcaagccctattcttgaccctgcctctctttgacattgaagtgtctacccctttgcat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54854516 |
caaaactactataaataaggggctaacccccggtttaatcactcaagccctattcttgaccctgcctctctttgacattgaagtgtctacccctttgcat |
54854417 |
T |
|
| Q |
301 |
tca |
303 |
Q |
| |
|
||| |
|
|
| T |
54854416 |
tca |
54854414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University