View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19608_high_5 (Length: 254)
Name: NF19608_high_5
Description: NF19608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19608_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 10 - 240
Target Start/End: Original strand, 43513460 - 43513690
Alignment:
| Q |
10 |
gcagagagtgagttgagctggacgaagaagacggaggaggagataatttcttgaatgatttgggcggtgaaagaatggctctgatcttcaatggatgaat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43513460 |
gcagagagtgagttgagctggacgaagaagacggaggaggagataatttcttgaatgatttgggcggtgaaagaatggctctgatcttcaatggatgaat |
43513559 |
T |
 |
| Q |
110 |
taatgatgaagaagcgcgatcgtattcttcaattatatttttcagatcttcatcgctggtgattgaaatcaatgtctctaaatctccgtttggtaatgga |
209 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43513560 |
taatgatgaagaagctcgatcgtattcttcaattatatttttcagatcttcatcgctggtgattgaaatcaatgtctctaaatctccgtttggtaatgga |
43513659 |
T |
 |
| Q |
210 |
catttcagtgtgactgatgaaccacataatt |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
43513660 |
catttcagtgtgactgatgaaccacataatt |
43513690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 155 - 211
Target Start/End: Original strand, 34589551 - 34589607
Alignment:
| Q |
155 |
atcttcatcgctggtgattgaaatcaatgtctctaaatctccgtttggtaatggaca |
211 |
Q |
| |
|
|||||||||| ||||||| |||||||| || ||||||||||||||||||||| |||| |
|
|
| T |
34589551 |
atcttcatcgttggtgatggaaatcaacgtttctaaatctccgtttggtaattgaca |
34589607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University