View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19608_low_5 (Length: 266)
Name: NF19608_low_5
Description: NF19608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19608_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 19 - 265
Target Start/End: Complemental strand, 16614998 - 16614752
Alignment:
| Q |
19 |
atgtttctcttgtcaaatcacttgaaattggactattttctccctcatcatagtctttattatcttcttcatcagctttcatgttcaagtcaagagtgtt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16614998 |
atgtttctcttgtcaaatcacttgaaattggactattttctccctcatcatagtcttcattatcttcttcatcagctttcatgttcaagtcaagagtgtt |
16614899 |
T |
 |
| Q |
119 |
gttgaagcttgattgtcttgaaaatgaaaattctctcttcttgttcccttcattttcttcaattcttggaatttttatcttgctaaacaagtcaagttca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16614898 |
gttgaagcttgattgtcttgaaaatgaaaattctctcttcttgttcccttcattttcttcaattcttggaatttttatcttgctaaacaagtcaagttca |
16614799 |
T |
 |
| Q |
219 |
gcacttcttttattacctaaacaaggtgattttgatgatgatgatga |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16614798 |
gcacttcttttattacctaaacaaggtgattttgatgatgatgatga |
16614752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 84 - 143
Target Start/End: Original strand, 52804378 - 52804440
Alignment:
| Q |
84 |
tcttcatcagctttcatgttcaagtcaagagtgt---tgttgaagcttgattgtcttgaaaat |
143 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||| |||| ||||||||||||||| ||||| |
|
|
| T |
52804378 |
tcttcatcagctttcatgttcagatcaagggtgttactgttaaagcttgattgtcttaaaaat |
52804440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University