View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19609_high_3 (Length: 245)
Name: NF19609_high_3
Description: NF19609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19609_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 41333366 - 41333607
Alignment:
| Q |
1 |
ttattgaattcaaatagggaacaatggcacactagatggacaaggtgaactgtggtggcaaaagtttcacaaggggaagctcacttatactaggccttac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41333366 |
ttattgaattcaaatagggaacaatggcacactagatggacaaggtgaactgtggtggcaaaagtttcacaaggggaagctcacttatactaggccttac |
41333465 |
T |
 |
| Q |
101 |
ctgattgaaatcatgtactcggataatatacagatatccaatcttactttggttaattctccatcctggaatgtccatcctgtttacagcaggttcatct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41333466 |
ctgattgaaatcatgtactcggataatatacagatatccaatcttactttggttaattctccatcctggaatgtccatcctgtttacagcaggttcatct |
41333565 |
T |
 |
| Q |
201 |
ttttctctttgcaatgtctattatcaatctactatattgttc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41333566 |
ttttctctttgcaatgtctattatcaatctactatattgttc |
41333607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 153 - 194
Target Start/End: Original strand, 29764837 - 29764878
Alignment:
| Q |
153 |
ttaattctccatcctggaatgtccatcctgtttacagcaggt |
194 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
29764837 |
ttaattctccatcatggaatgttcatcctgtttacagcaggt |
29764878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 89 - 195
Target Start/End: Complemental strand, 45075774 - 45075668
Alignment:
| Q |
89 |
actaggccttacctgattgaaatcatgtactcggataatatacagatatccaatcttactttggttaattctccatcctggaatgtccatcctgtttaca |
188 |
Q |
| |
|
|||||||| ||| ||||||| || ||||| || ||| | || || ||||||||||| |||||| | ||||| || || ||| ||||||||| ||||||| |
|
|
| T |
45075774 |
actaggccatacatgattgagattatgtattctgatcaaatccaaatatccaatctcactttgatcaattccccttcttggtttgtccatccagtttaca |
45075675 |
T |
 |
| Q |
189 |
gcaggtt |
195 |
Q |
| |
|
||||||| |
|
|
| T |
45075674 |
gcaggtt |
45075668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University