View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19609_low_2 (Length: 299)
Name: NF19609_low_2
Description: NF19609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19609_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 11 - 264
Target Start/End: Original strand, 43512584 - 43512835
Alignment:
| Q |
11 |
gaacctgtggagttaaccttgtaaattttgtgtacaagcttcttctttctaatttttactgcaatgcttctaattttattgtggaaaagtagtccttgac |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43512584 |
gaacctttggagttaaccttgtaaattttgtgtacaagcttcttctttctaatttttactgcaatgcttctaattttattgtggaaaagtagtccttgac |
43512683 |
T |
 |
| Q |
111 |
atatgaactaaactattttgggtgtgatctttatgtacttaattattatttgtcttaatttcaatttcaactcttccttcaaccagcacttgacaaaact |
210 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43512684 |
at--gaactaaactattttgggtgtgatctttatgtacttaattattatttgtcttaatttcaatttcaactcttccttcaaccagcacttgacaaaact |
43512781 |
T |
 |
| Q |
211 |
tttccatttatgcaacaaaatttttattttctgataaatcttcatatcctgcac |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43512782 |
tttccatttatgcaacaaaatttttattttctgataaatcttcatatcctgcac |
43512835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University