View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1960_low_7 (Length: 237)
Name: NF1960_low_7
Description: NF1960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1960_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 14 - 215
Target Start/End: Original strand, 42531266 - 42531467
Alignment:
| Q |
14 |
catcattgaatggacttgaagaacagcttgaaggtgaaggaaattgaagcacttctgtcatatttgaagaataatgatgaattgatggagtgaagtttga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42531266 |
catcattgaatggacttgaagaacagcttgaaggtgaaggaaattgaagcacttctgtcatatttgaagaataatgatgaattgatggagtgaagtttga |
42531365 |
T |
|
| Q |
114 |
ttcaagaaatggattatggaaggtggaatgtgacaatcattgaagcactatgttatgtgaatgtgacttcgggtaaccgctttacccgacccgaattcag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42531366 |
ttcaagaaatggattatggaaggtggaatgtgacaatcattgaagcactatgttatgtgaatgtgacttcgggtaaccgctttacccgacccgaattcag |
42531465 |
T |
|
| Q |
214 |
at |
215 |
Q |
| |
|
|| |
|
|
| T |
42531466 |
at |
42531467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University