View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19611_low_3 (Length: 316)
Name: NF19611_low_3
Description: NF19611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19611_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 298
Target Start/End: Complemental strand, 34822371 - 34822078
Alignment:
| Q |
1 |
tttggaccctaccatgtgcttgtctttaacattgctacgagataacgactggggaatatcactccatttatatctattgctttctgttaagataaaaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34822371 |
tttggaccctaccatgtgcttgtctttaacattgctacgagataacgactggggaatatcactccatttatatctattgctttctgttaagataaaaaga |
34822272 |
T |
 |
| Q |
101 |
cctcatgtcataatcgtatgcattaaaataaagatactacaacgaaaaagggagaaaaagctagacaaagaagataatttaaggattatttattttgaca |
200 |
Q |
| |
|
|||||| |||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34822271 |
cctcatatcataatcgtatgccttaaaaaaaagatactacaacgaaaaagggagaaaaagctagacaaagaagataatttaaggattgtttattttgaca |
34822172 |
T |
 |
| Q |
201 |
atatatataaatatcgaagtaatcgtcaattttgaaccgataggggtggggaggggaatgagtttctcaccgcttctttttacctaaggagaagttaa |
298 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34822171 |
ata--tataaatatcgaagtaatcgtcaattttgaaccgataggggtggggaggggaatgagtttctcaccgcttc--tttacctaaggagaagttaa |
34822078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University