View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19612_high_15 (Length: 338)
Name: NF19612_high_15
Description: NF19612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19612_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 12 - 321
Target Start/End: Complemental strand, 50055428 - 50055119
Alignment:
| Q |
12 |
atgaacttgttgagggagataatatgatggagattggaaaagaatcttcatttgagttgaattttgattatgatgattctcatgaaacatgtgaagaggt |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50055428 |
atgaagttgttgagggagataatatgatggagattggaaaagaatcttcatttgagttgaattttgattatgatgattctcatgaaacatgtgaagaggt |
50055329 |
T |
 |
| Q |
112 |
gaaggagaagtgtggagaacaaaatgaaaataatgattataataaggggaaaagaaaaatatctttgcagctagattatgatgcagtaatcattgcatgg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50055328 |
gaaggagaagtgtggagaacaaaatgaaaataatgattataataaggggaaaagaaaaatatctttgcagctagattatgatgcagtaatcattgcatgg |
50055229 |
T |
 |
| Q |
212 |
gatagccaaaagtgtccctggactaatggtgacaagccaattttggatgctgatgagaactggcctgattgcatggtataatttatatcttaatttcttc |
311 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
50055228 |
gatagccagaagtgtccctggactaatggtgacaagccaattttggatgctgatgagaactggcccgattgcatggtataatttatatcttaatttcttc |
50055129 |
T |
 |
| Q |
312 |
atggcttatt |
321 |
Q |
| |
|
|||||||||| |
|
|
| T |
50055128 |
atggcttatt |
50055119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University