View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19612_high_20 (Length: 274)
Name: NF19612_high_20
Description: NF19612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19612_high_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 36 - 231
Target Start/End: Original strand, 39492442 - 39492637
Alignment:
| Q |
36 |
tatacgacgcgaatgcaaggagcattagagttaccacctggcttcagatttcaccctactgatgatgagcttgtgaatcactacttgtgtagaaagtgtg |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39492442 |
tatacgacgcgaatgcaaggagcattagagttaccacctggcttcagatttcaccctactgatgatgagcttgtgaatcactacttgtgtagaaagtgtg |
39492541 |
T |
|
| Q |
136 |
cttcccttccaattgctgttcctattatcaaagaaattgatttgtataagtttgatccatggcatcttccaggtactttttcatcgtgtctggtgg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39492542 |
cttcccttccaattgctgttcctattatcaaagaaattgatttgtataagtttgatccatggcatcttccaggtactttttcatcgtgtctagtgg |
39492637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 72; Significance: 8e-33; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 46 - 213
Target Start/End: Original strand, 44370809 - 44370976
Alignment:
| Q |
46 |
gaatgcaaggagcattagagttaccacctggcttcagatttcaccctactgatgatgagcttgtgaatcactacttgtgtagaaagtgtgcttcccttcc |
145 |
Q |
| |
|
|||||||||| | |||||| ||||||||||| ||||||||||||||||||||||| || | |||||||||||||||||| | || |||||| | | |
|
|
| T |
44370809 |
gaatgcaaggtgaattagaattaccacctggtttcagatttcaccctactgatgaagaattggtgaatcactacttgtgtcgcaaatgtgctggtcaatc |
44370908 |
T |
|
| Q |
146 |
aattgctgttcctattatcaaagaaattgatttgtataagtttgatccatggcatcttccaggtactt |
213 |
Q |
| |
|
||| ||||||| || |||||||| |||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
44370909 |
tatttctgttcccgttgtcaaagaagttgatttgtataagtttgatccatggcagcttccaggtactt |
44370976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University