View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19612_low_22 (Length: 278)
Name: NF19612_low_22
Description: NF19612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19612_low_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 14 - 266
Target Start/End: Complemental strand, 5419433 - 5419181
Alignment:
| Q |
14 |
atatgttaggaaattgtataaaaggaatgaatcaatttggagtgtaatgtctaggtttgtatggggaatattgtggtcaatttatgtttgttgtgtttta |
113 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5419433 |
atatgttaggaaattgtataaagggaatgaatcaatttggagtgtaatgtctaggtttgtatggggaatattgtggtcaatttatgtttgttgtgttttg |
5419334 |
T |
|
| Q |
114 |
gttggtttattggtttcttcatttgtgtttagtggaattttgatcaagtatttcgtggagaaaccgattcggatgaatgaagttttgaatttcgattata |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5419333 |
gttggtttattggtttcttcatttgtgtttagtggaattttgatcaagtatttcgtggagaaaccgattcggatgaatgaagttttgaatttcgattata |
5419234 |
T |
|
| Q |
214 |
ctaagcttagtcctgtggcttatgttccgattatttcgtgtgatggtgttgtt |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5419233 |
ctaagcttagtcctgtggcttatgttccgattatttcgtgtgatggtgttgtt |
5419181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University