View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19612_low_27 (Length: 220)
Name: NF19612_low_27
Description: NF19612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19612_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 22 - 203
Target Start/End: Original strand, 39492660 - 39492841
Alignment:
| Q |
22 |
atttgaatgctaattttgttttatatacagaaatggctctttacggtgagaaagagtggtattttttctctccaagggatcgaaaatatccaaacggttc |
121 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39492660 |
atttcaatgctaattttgttttgtatacagaaatggctctttacggtgagaaagagtggtattttttctctccaagggatcgaaaatatccaaacggttc |
39492759 |
T |
 |
| Q |
122 |
acggccgaaccgggctgcgggaaccggatattggaaggcgaccggagctgataagccgattggaaagcctaaggcacttggt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39492760 |
acggccgaaccgggctgcgggaaccggatattggaaggcgaccggagctgataagccgattggaaagcctaaggcacttggt |
39492841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 69 - 184
Target Start/End: Original strand, 44371081 - 44371196
Alignment:
| Q |
69 |
gagaaagagtggtattttttctctccaagggatcgaaaatatccaaacggttcacggccgaaccgggctgcgggaaccggatattggaaggcgaccggag |
168 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||| ||||| |||||||| |||| || || ||||| |||| || |||||||| || || |||| |
|
|
| T |
44371081 |
gagaaagaatggtattttttctctccaagggacagaaagtatccgaacggttcgaggccaaatcgagctgctggaagtggttattggaaagctactggag |
44371180 |
T |
 |
| Q |
169 |
ctgataagccgattgg |
184 |
Q |
| |
|
||||||| || ||||| |
|
|
| T |
44371181 |
ctgataaaccaattgg |
44371196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 75 - 160
Target Start/End: Original strand, 39954320 - 39954405
Alignment:
| Q |
75 |
gagtggtattttttctctccaagggatcgaaaatatccaaacggttcacggccgaaccgggctgcgggaaccggatattggaaggc |
160 |
Q |
| |
|
|||||||| |||||||| ||| | || ||||||| |||||||||||| ||||||||||||| || || | |||||||||||||| |
|
|
| T |
39954320 |
gagtggtactttttctcgccacgagacagaaaatacccaaacggttcaaggccgaaccgggcggctgggtctggatattggaaggc |
39954405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University