View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19612_low_28 (Length: 209)

Name: NF19612_low_28
Description: NF19612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19612_low_28
NF19612_low_28
[»] chr7 (1 HSPs)
chr7 (19-99)||(37858847-37858927)


Alignment Details
Target: chr7 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 19 - 99
Target Start/End: Original strand, 37858847 - 37858927
Alignment:
19 atctctattcccactttctttgcaccttcttggtcttccaaacttagtcacacccatctcatcttccaccttctcaacaca 99  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37858847 atctctattcccactttctttgcaccttcttggtcttccaaacttagtcacacccatctcatcttccaccttctcaacaca 37858927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University