View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19613_high_23 (Length: 305)
Name: NF19613_high_23
Description: NF19613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19613_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 15 - 290
Target Start/End: Complemental strand, 14860721 - 14860446
Alignment:
| Q |
15 |
tatgttccttacctctctgcaatacaaatatttacaagcaataatttcaggtattttacnnnnnnnatgttagtgtccaaatgcactttttcttccctga |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14860721 |
tatgttccttacctctctgcaatacaaatatttacaaccaataatttcaggtattttactttttttatgttagtgtccaaatgcactttttcttccctga |
14860622 |
T |
 |
| Q |
115 |
tacggcaaatgttagtatgttaattttgaatgagtgtttcagagaagagattgattctggtagtgagacaagggattcgttcagcgattcttacagcgac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14860621 |
tacggcaaatgttagtatgttaattttgaatgcgtgtttcagagaagagattgattctggtagtgagacaagggattcgttcagcgattcttacagcgac |
14860522 |
T |
 |
| Q |
215 |
gatagcgagtgtgataagctatggacatcagaagaagaaggagcatctgagcaagatagtctctggcatatgaatg |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14860521 |
gatagcgagtgtgataagctatggacatcatcagaagaaggagcatctgagcaagatagtctctggcatatgaatg |
14860446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University