View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19613_high_34 (Length: 238)
Name: NF19613_high_34
Description: NF19613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19613_high_34 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 11914487 - 11914270
Alignment:
| Q |
18 |
gtatcgtcaccaaaaatcaaatatttagagagataaaaggaccctatcttatgcttaaagtgcgacaacccacaccaaacggctataattggcgttacaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11914487 |
gtatcgtcaccaaaaatcaaatatttagagagataaa-ggaccctatcttatgcttaaagtgcgacaacccacaccaaacggctataattggcgttacaa |
11914389 |
T |
|
| Q |
118 |
attacacttaaccttctaaattccaattatcatttatagtgaaagagaaaaacaaacgtagcctcaaaaacaaagatcctttctttccttatactgggtt |
217 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11914388 |
attacacttacccttctaaattccaattatcatttatagtgaaagagagaaacaaacgtagcctcaaaaacaaagatcctttctttccttatactgggtt |
11914289 |
T |
|
| Q |
218 |
ttggtttttcttttatttt |
236 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
11914288 |
ttggtttttcttttttttt |
11914270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University