View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19613_high_35 (Length: 236)
Name: NF19613_high_35
Description: NF19613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19613_high_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 7622689 - 7622913
Alignment:
| Q |
1 |
ccaattctcaggatcccttgctatggcccatgcattaacatagactagagtttttggtttaatctcataaccatctatgttacaactttctattgtttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7622689 |
ccaattctcaggatcccttgctatggcccatgcattaacatagactagagtttttggtttaatctcataaccatctatgttacaactttctattgtttct |
7622788 |
T |
 |
| Q |
101 |
cttggtaatagtaatggtgatggagggaataatcttaatgtctctttcactactgatttaagataaggaagcttttcaatatcatcttcatttataaaat |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7622789 |
cttggcaatagtaatggtgatggagggaataatcttaatgtctctttcactactgatttaagataaggaagcttttcaatatcatcttcatttataaaat |
7622888 |
T |
 |
| Q |
201 |
ctttgtcttcatataagtttctgat |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
7622889 |
ctttgtcttcatataagtttctgat |
7622913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 7627240 - 7627464
Alignment:
| Q |
1 |
ccaattctcaggatcccttgctatggcccatgcattaacatagactagagtttttggtttaatctcataaccatctatgttacaactttctattgtttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7627240 |
ccaattctcaggatcccttgctatggcccatgcattaacatagactagagtttttggtttaatctcataaccatctatgttacaactttctattgtttct |
7627339 |
T |
 |
| Q |
101 |
cttggtaatagtaatggtgatggagggaataatcttaatgtctctttcactactgatttaagataaggaagcttttcaatatcatcttcatttataaaat |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7627340 |
cttggcaatagtaatggtgatggagggaataatcttaatgtctctttcactactgatttaagataaggaagcttttcaatatcatcttcatttataaaat |
7627439 |
T |
 |
| Q |
201 |
ctttgtcttcatataagtttctgat |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
7627440 |
ctttgtcttcatataagtttctgat |
7627464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 7634376 - 7634600
Alignment:
| Q |
1 |
ccaattctcaggatcccttgctatggcccatgcattaacatagactagagtttttggtttaatctcataaccatctatgttacaactttctattgtttct |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7634376 |
ccaattctcaggatcccttcctatggcccatgcattaacatacactaaagtttttggtttaatctcataaccatctatgttacaattttctattgtttct |
7634475 |
T |
 |
| Q |
101 |
cttggtaatagtaatggtgatggagggaataatcttaatgtctctttcactactgatttaagataaggaagcttttcaatatcatcttcatttataaaat |
200 |
Q |
| |
|
||||||| ||||||||||||||| || |||||||| | |||||||||||| |||| |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7634476 |
cttggtactagtaatggtgatggtggaaataatctcattgtctctttcaccactgctttaagataaggtagcttttcaatatcatcttcatttataaaat |
7634575 |
T |
 |
| Q |
201 |
ctttgtcttcatataagtttctgat |
225 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
7634576 |
atttgtcttcatataagtttctgat |
7634600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University