View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19613_high_36 (Length: 224)
Name: NF19613_high_36
Description: NF19613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19613_high_36 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 164; Significance: 8e-88; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 18 - 209
Target Start/End: Complemental strand, 23282439 - 23282248
Alignment:
| Q |
18 |
catttggcttacttagctaattgcattaagttgaaggatcaaggatgtaattaaatcagtgtctcacggcttattgttctcttctcttttgtaggtattn |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
23282439 |
catttggcttacttagctaattgcattaagttgaaggatcaaggatgtaattaaatcagtgtctcaccgcttattgttctcttctcttttgtaggtatta |
23282340 |
T |
 |
| Q |
118 |
nnnnnnngtcagttaaaatgacttggattgtgaccgcaattgtagtggttaagttttctcaactatttcctcatgtgtttcatttagaatta |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23282339 |
aaaaaaagtcagttaaaatgacttggattgtgaccgcaattgtagtggttaagttttctcaactatttcctcatgtgtttcatttagaatta |
23282248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 126 - 209
Target Start/End: Complemental strand, 23288967 - 23288884
Alignment:
| Q |
126 |
tcagttaaaatgacttggattgtgaccgcaattgtagtggttaagttttctcaactatttcctcatgtgtttcatttagaatta |
209 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| | ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
23288967 |
tcagttacaatgacttggattgtgaccgcaattgtagatatctagttttctcaactatttccctatgtgtttcatttagaatta |
23288884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University