View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19613_high_37 (Length: 219)
Name: NF19613_high_37
Description: NF19613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19613_high_37 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 51 - 201
Target Start/End: Complemental strand, 17330080 - 17329931
Alignment:
| Q |
51 |
ttcaccacttctggcacatcttgaaaaacaaaaagaacctttatctgcttgacccatcaatcataatttgttccaccttcaagcagtggtaggataccac |
150 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
17330080 |
ttcaccacttctgacacatcttgaaaaacaaaaagaacctttatctgcttgacccatcaatcataatttgttccaccttcaagcagt-gtaggatacctt |
17329982 |
T |
|
| Q |
151 |
tgaatttcaccatgagttacctttgatttcaactaaaagctttggataatg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17329981 |
tgaatttcaccatgagttacctttgatttcaactaaaagctttggataatg |
17329931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University