View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19613_low_28 (Length: 282)
Name: NF19613_low_28
Description: NF19613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19613_low_28 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 72 - 282
Target Start/End: Original strand, 34899337 - 34899547
Alignment:
| Q |
72 |
cagaagagtcttgctcaattttaaaaatcagggctatacaattcatcaatgaannnnnnnncccttttgttttgacacttctctaattgtttcttgtggt |
171 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899337 |
cagaagagtcttgctcaattctaaaaatcagggctatacaattcatcaatgaattttttttcccttttgttttgacacttctctaattgtttcttgtggt |
34899436 |
T |
|
| Q |
172 |
gctatttggatccttcttaaactcaacttgtatttattgggatctctttttcgtttaatataatttttgacttcttcaacnnnnnnnntctatgaagaag |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34899437 |
gctatttggatccttcttaaactcaacttgtatttattgggatctctttttcgtttaatataatttttgacttcttcaacaaaaaaaatctatgaagaag |
34899536 |
T |
|
| Q |
272 |
tgtctgctaag |
282 |
Q |
| |
|
||||||||||| |
|
|
| T |
34899537 |
tgtctgctaag |
34899547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University