View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19615_high_51 (Length: 363)
Name: NF19615_high_51
Description: NF19615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19615_high_51 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-106; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 17 - 216
Target Start/End: Original strand, 39161320 - 39161519
Alignment:
| Q |
17 |
atttggctcaggtgataaagctaatgcttgaaattcggttcaaattggagattaaatttttggaacccttacccttctgctattaaacaaaaatccttga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39161320 |
atttggctcaggtgataaagctaatgcttgaaattcggttcaaattggagattaaatttttggaacccttacccttctgctattaaacaaaaatccttga |
39161419 |
T |
|
| Q |
117 |
gtctattgttgttttaaaactttggaaattttgtaccacagccagaactgaagtacccacatctatttccaaagggttccatttgggataagtaagtaga |
216 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39161420 |
gtctattgttgttttaatactttggaaattttgtaccacagccagaactgaagtacccacatctatttccaaagggttccatttgggataagtaagtaga |
39161519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 265 - 351
Target Start/End: Original strand, 39161568 - 39161654
Alignment:
| Q |
265 |
gggataagtaagctgatgctgatatactttgttgttgtgctgcgttaaatttttcaaatcataaatcacctcgcaggtttccatatt |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39161568 |
gggataagtaagctgatgctgatatactttgttgttgtgctgcgttaaatttttcaaatcataaatcacctcgcaggtttccatatt |
39161654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University