View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19615_high_76 (Length: 265)
Name: NF19615_high_76
Description: NF19615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19615_high_76 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 53578686 - 53578931
Alignment:
| Q |
1 |
tgggacaaatcaagcacaagaagaaacaaatnnnnnnnttgaaagacatggaagtgaagaaacatgtaaacacttttcaaaagatgttgtttcatgttgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53578686 |
tgggacaaatcaagcacaagaagaaacaaataaaaaaatcgaaagacatggaagtgaagaaacatgtaaacacttttcaaaagatgttgtttcatgttgg |
53578785 |
T |
|
| Q |
101 |
gaaaccaaaatctgaaggaagaaggaaatcagatgcatgtgcagttcaagataaaaaatatgcaattgaggaaagagcaacacatgtgagtcaaatgaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53578786 |
gaaaccaaaatctgaaggaagaaggaaatcagatgcatgtgcagttcaagataaaaaatatgcaattgaggaaagagcaacacatgtgagtcaaatgaaa |
53578885 |
T |
|
| Q |
201 |
cgttttgcaagtggacgtgacacttttgctaattttgattggaagg |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53578886 |
cgttttgcaagtggacgtgacacttttgctaattttgattggaagg |
53578931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University