View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19615_high_85 (Length: 249)
Name: NF19615_high_85
Description: NF19615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19615_high_85 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 4 - 224
Target Start/End: Original strand, 1360675 - 1360895
Alignment:
| Q |
4 |
agagaaaagaaccaacaccaacagtgaaagtatcaatcccaaaaggccaaaacacaatcttctttctattttacaataaaataatcattgcatggctctc |
103 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1360675 |
agagagaagaaccaacaccaacagtgaaagaatcaatcccaaaaggccaaaacacaatcttctttctattttacactaaaataatcattgcatggctctc |
1360774 |
T |
 |
| Q |
104 |
gtggaagagcatagcctcctcgtggaaataaaataacgttggattggatgtgtttttcacaagtaattatatatttgaatgcgtgtcacacgtggcagtg |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1360775 |
gtggaagagcatagcctcctcgtggaaataaaataacgttggattggatgtgttttttacaagtaataatatatttgaatgcgtgtcacacgtggcagtg |
1360874 |
T |
 |
| Q |
204 |
attgtttatacaaaaataact |
224 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
1360875 |
attgtttatacaaaaataact |
1360895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 13 - 47
Target Start/End: Complemental strand, 3203475 - 3203441
Alignment:
| Q |
13 |
aaccaacaccaacagtgaaagtatcaatcccaaaa |
47 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3203475 |
aaccaacaccaacagtgaaagtatcgatcccaaaa |
3203441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University