View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19615_low_100 (Length: 220)
Name: NF19615_low_100
Description: NF19615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19615_low_100 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 4749541 - 4749747
Alignment:
| Q |
1 |
taatcatccacatgtcttcgaaagagccaaggttttaatactattaattaatgtggcattttcaaaatttgttactgnnnnnnnnnn-aacaaacaaaac |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4749541 |
taatcatccacatgtcttcgaaagagccaaggttttaatactattaattaatgtggcattttcaaaatttgttactgtttttttttttaacaaacaaaac |
4749640 |
T |
|
| Q |
100 |
tatgaaccctttcagaaagaacaagaagagattatggcaagaaggccttccgatcaaaaaggaattacacatacggaaattaggcaaatgaaatatcttt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4749641 |
tatgaaccctttcagaaagaacaagaagagattatggcaagaaggccttccgatcaaaaaggacttacacatacggaaattaggcaaatgaaatatcttt |
4749740 |
T |
|
| Q |
200 |
cacaggt |
206 |
Q |
| |
|
| ||||| |
|
|
| T |
4749741 |
ctcaggt |
4749747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 206
Target Start/End: Original strand, 4758195 - 4758293
Alignment:
| Q |
108 |
ctttcagaaagaacaagaagagattatggcaagaaggccttccgatcaaaaaggaattacacatacggaaattaggcaaatgaaatatctttcacaggt |
206 |
Q |
| |
|
|||||||||||||||||||||||| |||| || |||||||||| |||||||||| | | | || |||||||| ||||||| ||||||||||| |||| |
|
|
| T |
4758195 |
ctttcagaaagaacaagaagagatcatggaaacaaggccttccactcaaaaaggactgaaccttaaggaaattaagcaaatgcaatatctttcaaaggt |
4758293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University