View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19615_low_103 (Length: 202)
Name: NF19615_low_103
Description: NF19615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19615_low_103 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 4e-43; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 64 - 189
Target Start/End: Complemental strand, 16167279 - 16167154
Alignment:
| Q |
64 |
aaattaatctaaagaaattcaattctcaaaattgaatccaacgccgtcagaagtagaannnnnnnaagtgacggtcagaagtagacgagcatatataaat |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| | ||||||||||||| || |
|
|
| T |
16167279 |
aaattaatctaaagaaattcaattctcaaaattgaatccaacgccgtcagaagtagaatttttttaagtgacggccagaagcacacgagcatatatatat |
16167180 |
T |
|
| Q |
164 |
tctaattattaaaattataataaaaa |
189 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
16167179 |
tctaattattaaaattataataaaaa |
16167154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 15 - 82
Target Start/End: Complemental strand, 16167358 - 16167291
Alignment:
| Q |
15 |
atatagtcttatgatatatgaatacttatttcaatagataaattcgaataaattaatctaaagaaatt |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16167358 |
atatagtcttatgatatatgaatacttatttcaatagataaattcgaataaattaatctaaagaaatt |
16167291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University