View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19615_low_36 (Length: 411)
Name: NF19615_low_36
Description: NF19615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19615_low_36 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 255; Significance: 1e-142; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 130 - 396
Target Start/End: Complemental strand, 24266023 - 24265758
Alignment:
| Q |
130 |
tttattattgtttaaaaagagtgttgtaaaagtaattaatgaaaaatggtgtgtgaatatcattgttggtaaataaagtcattatagaaaattgattttt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24266023 |
tttattattgtttaaaaagagtgttgtaaaagtaattaatgaaaaatggtgtgtgaatatcattgttggtaaataaagtcattatagaaaattgattttt |
24265924 |
T |
|
| Q |
230 |
gaatgtgatggggatatataacaaactgacctgaatcaatgttagcaatgattgtaccctcaccatatcttgccttctcccatatggagtctttgggaac |
329 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24265923 |
gaatgtgatggg-atatataacaaactgacctgaatcaatgttagcaatgattgtaccctcaccatatcttcccttctcccatatggagtctttgggaac |
24265825 |
T |
|
| Q |
330 |
cactccataattgttctctagcccaagaaattcccatgatcttgtggtttgcaattcatgccctttg |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24265824 |
cactccataattgttctctagcccaagaaattcccatgatcttgtggtttgcaattcatgccctttg |
24265758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 19 - 134
Target Start/End: Complemental strand, 24268413 - 24268298
Alignment:
| Q |
19 |
atgctattactggagcttgttttactcccacttcagtttttgccttagtcatgtatgccatgggggtcctgttaggattaacatcataattaagcgcata |
118 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24268413 |
atgctattactggagctggttttactcccacttcagtttttgccttagtcatgtatgccatgggggtcctgttaggattaacatcataattaagcgcata |
24268314 |
T |
|
| Q |
119 |
catcataagcgtttat |
134 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
24268313 |
catcataagcgtttat |
24268298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 258 - 317
Target Start/End: Complemental strand, 42309589 - 42309530
Alignment:
| Q |
258 |
acctgaatcaatgttagcaatgattgtaccctcaccatatcttgccttctcccatatgga |
317 |
Q |
| |
|
||||| ||||| |||| |||||||||| | ||||||||||||||||||||||| ||||| |
|
|
| T |
42309589 |
acctgtatcaaggttaccaatgattgtgtcttcaccatatcttgccttctcccaaatgga |
42309530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University