View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19615_low_37 (Length: 398)
Name: NF19615_low_37
Description: NF19615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19615_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 17 - 290
Target Start/End: Complemental strand, 37150155 - 37149890
Alignment:
| Q |
17 |
aaattgatcctgctaatgggatttcactgtctgattatcttggttctttaggttcgttttccacttttattgataaaaattataagtatagttgtaaatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37150155 |
aaattgatcctgctaatgggatttcactgtctgattatcttggttctttaggttcgttttccacttttattgataaaaattataagtatagttgtaaatt |
37150056 |
T |
 |
| Q |
117 |
ttattcaattagtttaaaaggtttaactaaagtataaaaaattagaagaaaaattattccactaaatttaagtattatttttctataaaactgta-nnnn |
215 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37150055 |
ttattcaattagt---------ttaactaaagtataaaaaattagaagaaaaattattccactaaatttaagtattatttttctataaaactgtatattt |
37149965 |
T |
 |
| Q |
216 |
nnnngaagaaatatataaaactatatgtgtgttttattatcttttaaagatactttgtagtattcaagtgggtct |
290 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37149964 |
ttttgaagaaatatataaaactatatgcgtgttttattatcttttaaagatactttgtagtattcaagtgggtct |
37149890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 17 - 77
Target Start/End: Complemental strand, 37155301 - 37155241
Alignment:
| Q |
17 |
aaattgatcctgctaatgggatttcactgtctgattatcttggttctttaggttcgttttc |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
37155301 |
aaattgatcctgctaatgggatttcactgtcagattatcttggtactttaggttcgttttc |
37155241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 17 - 69
Target Start/End: Complemental strand, 37161035 - 37160983
Alignment:
| Q |
17 |
aaattgatcctgctaatgggatttcactgtctgattatcttggttctttaggt |
69 |
Q |
| |
|
|||||||| || | ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37161035 |
aaattgatacttcaaatgggatttctttgtctgattatcttggttctttaggt |
37160983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University