View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19615_low_51 (Length: 366)
Name: NF19615_low_51
Description: NF19615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19615_low_51 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 7 - 351
Target Start/End: Original strand, 3419305 - 3419650
Alignment:
| Q |
7 |
aagaaaataattgtatttataaatggaaagagttttaattttatcttccttctttatgatctatcctagtttctgggtaacctcttgtcaaaacaacaaa |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3419305 |
aagaatataattgtatttataaatggaaagagttttaattttatcttccttctttatgatctatcctagtttctgggtaacctcttgtcaaaacaacaaa |
3419404 |
T |
|
| Q |
107 |
attgataacctcaccaacagaaaccccatgtccattcgtgctcgtttaattgaatggctacaacaaattgtgtaatgctccaacaatttttgttttcaag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3419405 |
attgataacctcaccaacagaaaccccatgtccattcgtgctcgtttaattgaatggctacaacaaattgtgtaatgctccaacaatttttgttttcaag |
3419504 |
T |
|
| Q |
207 |
ccaactgtcctcacaatttagcaagaattcattgttgctggcacttgtcgcaccagaaaacacatctcattgtcgttgtcataattggggaccacattat |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3419505 |
ccaactgtcctcacaatttagcaagaattcattgttgctggcacttgtcgcaccagaaaacacatctcattgtcgttgtcataattggggaccacattat |
3419604 |
T |
|
| Q |
307 |
ctgcattctta-tattattaatataaatggcatttacttgattatt |
351 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3419605 |
ctgcattcttattattattaatataaatggcatttacttgattatt |
3419650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University