View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19615_low_66 (Length: 321)
Name: NF19615_low_66
Description: NF19615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19615_low_66 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 311
Target Start/End: Complemental strand, 2323778 - 2323474
Alignment:
| Q |
1 |
tctttgtttaaagcagtattattttgtctgactctgttaatttggaatcaaatccaatcactctcttctcagcattaaattatttttcattaatttgcgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2323778 |
tctttgtttaaagcagtattattttgtctgactcttttaatttggaatcaaatcca-tcactctcttctcagcattaaattatttttcatcaatttgcgt |
2323680 |
T |
 |
| Q |
101 |
acattatcttttaccatatttaacaaatcacccacaaattatcaagttttgatgttagaaaattggctgctatagtgttacgtcatatatagctgtgtaa |
200 |
Q |
| |
|
|||||||||| |||||||||| |||||||| ||||||||||||||||||||||| | |||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
2323679 |
acattatcttgcaccatatttatcaaatcacacacaaattatcaagttttgatgtcataaaattggctgctatagtgttacgtc----atagcagtgtaa |
2323584 |
T |
 |
| Q |
201 |
tcaaaaacattgaacaagattattcttttatcatactcttttatttattattatgagacttgacaaaacgatggtagtgttaggcaaattcatttacttc |
300 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2323583 |
t-aaaaacattgaacaagattattcttttatcatactcttttatttattattatgagacttgacaaaacgatggtagtgttaggaaaattcatttacttc |
2323485 |
T |
 |
| Q |
301 |
ttctccctttg |
311 |
Q |
| |
|
|||||| |||| |
|
|
| T |
2323484 |
ttctccgtttg |
2323474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University