View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19615_low_67 (Length: 319)
Name: NF19615_low_67
Description: NF19615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19615_low_67 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 265; Significance: 1e-148; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 18 - 306
Target Start/End: Original strand, 4498637 - 4498925
Alignment:
| Q |
18 |
aacttaaacaagttttggagggtggaaattccgatgcaggtttcttcaacacattagatttctacataggaatgggagttggatttgcagcagggttttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4498637 |
aacttaaacaagttttggagggtggaaattccgatgcaggtttcttcaacacatcagatttctacataggaatgggagttggatttgcagcagggttttg |
4498736 |
T |
 |
| Q |
118 |
gggggtttgcattgctattttctttatcagaacttgcaggcatgcttattttcattttcttgaccgcttgaaagatcttgtttatgatacctttgtcttt |
217 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4498737 |
gggggtttgcattgctactttcttgatcagaacttgcaggcatgcttattttcattttcttgaccgcttgaaagatcttgtttatgatacctttgtcttt |
4498836 |
T |
 |
| Q |
218 |
atctgtcaagagggacgaaaatgtgggaattggaccatcccgctgctaggagtctggtcgatattgaagttgtattgaagtctcgtatt |
306 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4498837 |
atctgtcaagagggatgaaaatgtgggaattggaccataccgccgctaggagtctggtcgatattgaagttgtattgaagtctcgtatt |
4498925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 23 - 216
Target Start/End: Complemental strand, 4329267 - 4329074
Alignment:
| Q |
23 |
aaacaagttttggagggtggaaattccgatgcaggtttcttcaacacattagatttctacataggaatgggagttggatttgcagcagggttttgggggg |
122 |
Q |
| |
|
||||||||||||||| |||||||||| ||||| |||||| | |||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4329267 |
aaacaagttttggagcgtggaaattctgatgctggtttcgttgacacatcagatttctacgtaggaatgggagttggatttgcagcagggttttgggggg |
4329168 |
T |
 |
| Q |
123 |
tttgcattgctattttctttatcagaacttgcaggcatgcttattttcattttcttgaccgcttgaaagatcttgtttatgatacctttgtctt |
216 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4329167 |
tttgcattgctattttctttaacagaacttgcaggcatgcttattttcattttcttgaccgcttgaaagatcttgtttatgagacctttgtctt |
4329074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 220 - 306
Target Start/End: Complemental strand, 4329036 - 4328946
Alignment:
| Q |
220 |
ctgtcaagagggacgaaaatgtgggaattggaccatcccgctg----ctaggagtctggtcgatattgaagttgtattgaagtctcgtatt |
306 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||| |||| ||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
4329036 |
ctgtcaagagggatgaaaatgtggaaattggaccataccgcacgccactaggagtctggtcgatattgaagttgcattgaagtctcatatt |
4328946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University