View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19615_low_82 (Length: 258)

Name: NF19615_low_82
Description: NF19615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19615_low_82
NF19615_low_82
[»] chr5 (2 HSPs)
chr5 (91-246)||(11639388-11639543)
chr5 (1-43)||(11639572-11639614)


Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 91 - 246
Target Start/End: Complemental strand, 11639543 - 11639388
Alignment:
91 gtcttgtctcatatttgtcttccagtaactattactgctttagagttttgggttttgacctttacagtctttgattttctttttatgaggtaaattgcat 190  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11639543 gtcttgtctcatatttgtcttccagtaactagtactgctttagagttttgggttttgacctttacagtctttgattttctttttatgaggtaaattgcat 11639444  T
191 gttgatctagcattcttgtgtcatatgccatatagcatatctcattattttctttc 246  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11639443 gttgatctagcattcttgtgtcatatgccatatagcatatctcattattttctttc 11639388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 11639614 - 11639572
Alignment:
1 aggaaattgtcaactaccattatattaccatagtatatgactt 43  Q
    |||||||||||||||||||||||||||||||||||||||||||    
11639614 aggaaattgtcaactaccattatattaccatagtatatgactt 11639572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University