View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19615_low_89 (Length: 248)
Name: NF19615_low_89
Description: NF19615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19615_low_89 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 13 - 245
Target Start/End: Original strand, 43164112 - 43164344
Alignment:
| Q |
13 |
aaaaacaaaatgtaaagggtttgaaaattagacaacaagctatttgtgagtgactgaaaggttgccattaactgtttttgaggtcactcttgtgaaggat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43164112 |
aaaaacaaaatgtaaagggtttgaaaattagacaactggctatttgtgagtgactgaaaggttgccattaactgtttttgaggtcactcttgtgaaggat |
43164211 |
T |
 |
| Q |
113 |
agaaatcttcatgtcgaattcgaggtcattcaacacacaaatgacattcagcgatcgaagagtagagatcattctgcccgtgtgagtccagatcagcttt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43164212 |
agaaatcttcatgtcgaattcgaggtcattcaacacacaaatgacattcagcgatcgaagagcagagatcattctgcccgtgtgagtccagatcagcttt |
43164311 |
T |
 |
| Q |
213 |
taagtgtgtgttgtactgctatacatctctgct |
245 |
Q |
| |
|
| |||||||||||||||||||||| |||||||| |
|
|
| T |
43164312 |
tgagtgtgtgttgtactgctatacgtctctgct |
43164344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University