View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19615_low_92 (Length: 240)
Name: NF19615_low_92
Description: NF19615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19615_low_92 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 8 - 92
Target Start/End: Original strand, 33406989 - 33407073
Alignment:
| Q |
8 |
attatactattgtagtttactagtgaggatagtaatgtttaacatttgggtattgtaagcatctatctcacaattgaatttgtgg |
92 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33406989 |
attatattattgtagtttactagtgaggatagtaatgtttaacatttgggtattgtaagcatctatctcacaattgaatttgtgg |
33407073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 146 - 225
Target Start/End: Original strand, 33407123 - 33407202
Alignment:
| Q |
146 |
gctcagattcctactatatgatacaattaattagtactattgtgaatgatttttgtactatttcacttgcgttcatgtgt |
225 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33407123 |
gctcagttttctactatatgatacaattaattagtactatagtgaatgatctttgtactatttcacttgcgttcatgtgt |
33407202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University