View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19615_low_93 (Length: 239)
Name: NF19615_low_93
Description: NF19615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19615_low_93 |
 | |
|
| [»] chr2 (5 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 17 - 239
Target Start/End: Complemental strand, 37161035 - 37160813
Alignment:
| Q |
17 |
aaattgatcctgctaatgggatttcactgtctgattatcttggttctttaggtcagttttttctatacatgtctacttttcattccttaggtaattgtga |
116 |
Q |
| |
|
|||||||| || | ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37161035 |
aaattgatacttcaaatgggatttctttgtctgattatcttggttctttaggtcagttttttctatacatgtctacttttcattccttaggtaattgtga |
37160936 |
T |
|
| Q |
117 |
tttttccaaattcattgtaaatctaagtatacacttaattaattgcaggagtaccggggtttgcagcatgggtgggaatagacgtactagcagatccaaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37160935 |
tttttccaaattcattgtaaatctaagtatacacttaattaattgcaggagtaccggggtttgcagcatgggtgggaatagaggtactagcagatccaaa |
37160836 |
T |
|
| Q |
217 |
gccaggatcaaatgtgttcatat |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
37160835 |
gccaggatcaaatgtgttcatat |
37160813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 156 - 239
Target Start/End: Complemental strand, 37149762 - 37149679
Alignment:
| Q |
156 |
taattgcaggagtaccggggtttgcagcatgggtgggaatagacgtactagcagatccaaagccaggatcaaatgtgttcatat |
239 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||| ||||||| | | |||||||||| ||||||||||||||||| |
|
|
| T |
37149762 |
taattgcaggagtacctgggtttgcagcatggttgggaatagaggtactaggaaacccaaagccagcatcaaatgtgttcatat |
37149679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 17 - 69
Target Start/End: Complemental strand, 37150155 - 37150103
Alignment:
| Q |
17 |
aaattgatcctgctaatgggatttcactgtctgattatcttggttctttaggt |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37150155 |
aaattgatcctgctaatgggatttcactgtctgattatcttggttctttaggt |
37150103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 157 - 239
Target Start/End: Complemental strand, 37153722 - 37153640
Alignment:
| Q |
157 |
aattgcaggagtaccggggtttgcagcatgggtgggaatagacgtactagcagatccaaagccaggatcaaatgtgttcatat |
239 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||||| ||| ||| ||||||||| ||||||||| |||| ||||||| |
|
|
| T |
37153722 |
aattgcaggagtagcggggtttgcagcatggttgggaatagaggtaataggagatccaaaaccaggatcacatgtattcatat |
37153640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 17 - 69
Target Start/End: Complemental strand, 37155301 - 37155249
Alignment:
| Q |
17 |
aaattgatcctgctaatgggatttcactgtctgattatcttggttctttaggt |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
37155301 |
aaattgatcctgctaatgggatttcactgtcagattatcttggtactttaggt |
37155249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University