View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19615_low_99 (Length: 221)
Name: NF19615_low_99
Description: NF19615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19615_low_99 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 29 - 204
Target Start/End: Original strand, 49425755 - 49425929
Alignment:
| Q |
29 |
tcaattgatgaaaaatgttttgagagatcaactactcgtttaatggaagtaagttgagtttttatgagcttggtgtttgtggcttttatgttttataaaa |
128 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
49425755 |
tcaattgatgaaaaatgttt-gagatatcaactactcgtttaatggaagtaagttaagtttttatgagcttggtgtttgtggcttttatgttttatgaaa |
49425853 |
T |
 |
| Q |
129 |
taatttgctcgagtacatgaagttgtaacatgacattgccaatatgaattggcgaaatcttaagagcgtaagaaat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49425854 |
taatttgctcgagtacatgaagttgtaacatgacattgccaatatgaattggcgaaatcttaagagcgtaagaaat |
49425929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 101 - 167
Target Start/End: Original strand, 49423669 - 49423735
Alignment:
| Q |
101 |
gtgtttgtggcttttatgttttataaaataatttgctcgagtacatgaagttgtaacatgacattgc |
167 |
Q |
| |
|
|||| ||| |||||||| ||| || ||||||||||||||||| |||||||||||||| ||| ||||| |
|
|
| T |
49423669 |
gtgtctgttgcttttatatttcatgaaataatttgctcgagtgcatgaagttgtaacgtgatattgc |
49423735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University