View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19617_high_9 (Length: 294)
Name: NF19617_high_9
Description: NF19617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19617_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 280
Target Start/End: Original strand, 8854468 - 8854747
Alignment:
| Q |
1 |
gtacgttgaatttaaaatttaaaaactatttgaaatatgaaccgtctaatcttcatcaatggttatgattgaccgactgcgtgaatgcttgatatttcga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8854468 |
gtacgttgaatttaaaatttaaaaactacttgaaatatgaaccgtctaatcttcatcaatggttatgattgaccgaccgcgtgaatgcttgatatttcga |
8854567 |
T |
 |
| Q |
101 |
ctacacttacaatgagtggtcttcagtgcatgattctgagacaacaaagggagtgatggaagtgtggaaaggctcacacactgtggagaagaagttgatg |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8854568 |
ctacacttacgatgagtggtcttcagtgcatgattctgagacaacaaagggagtgatggaagtgaggaaaggctcacacactgtggagaagaagttgatg |
8854667 |
T |
 |
| Q |
201 |
attgaaaagaagccttgcaatcaaagtggttagatgaaaaggatatagtgagagaagatgagattaaggccattgttaat |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8854668 |
attgaaaagaagccttgcaatcaaagtggttagatgaaaaggatatagtgagagaagatgagattaaggccattgttaat |
8854747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University