View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19617_low_12 (Length: 281)
Name: NF19617_low_12
Description: NF19617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19617_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 18 - 161
Target Start/End: Original strand, 7666885 - 7667030
Alignment:
| Q |
18 |
agatgaagtctccgtcgaaaatcatccccgtgtcacaaccagagaatctttctaagcacaca--gacaaaattagatgaggaaatatcaatctaaaaaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7666885 |
agatgaagtctccgtcgaaaatcatccccgtgtcacaaccagagaatctttctaagcacacaaagacaaaattagatgaggaaatatcaatctaaaaaat |
7666984 |
T |
 |
| Q |
116 |
aacatcaaagtcccctttggaaactcaaaggaagttaccttcaacc |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7666985 |
aacatcaaagtcccctttggaaactcaaaggaagttaccttcaacc |
7667030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 22 - 161
Target Start/End: Original strand, 7087119 - 7087259
Alignment:
| Q |
22 |
gaagtctccgtcgaaaatcatccccgtgtcacaaccagagaatctttctaagcacac--agacaaaattagatgaggaaatatcaatctaaaaaataaca |
119 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |||||||||||||||||| | |||| ||||| |
|
|
| T |
7087119 |
gaagtcaccatcgaaaatcatccccgtgtcacaaccagagaatctttctaagcacacaaaaacaaaactagatgaggaaatatcaacatcaaaactaaca |
7087218 |
T |
 |
| Q |
120 |
tcaaagtcccctttggaaactcaaaggaagttaccttcaacc |
161 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
7087219 |
ccaaagtcccatttggaaactcaaaggaagtt-ccttcaacc |
7087259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 228 - 264
Target Start/End: Original strand, 7087326 - 7087362
Alignment:
| Q |
228 |
tactagccaaccgaatcaacatacaaaagcatcttct |
264 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7087326 |
tactagccaaccgaatcaacataccaaagcatcttct |
7087362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 228 - 264
Target Start/End: Original strand, 7667097 - 7667133
Alignment:
| Q |
228 |
tactagccaaccgaatcaacatacaaaagcatcttct |
264 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7667097 |
tactagccaaccgaatcaacatgcaaaagcatcttct |
7667133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University