View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19617_low_15 (Length: 237)
Name: NF19617_low_15
Description: NF19617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19617_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 14 - 220
Target Start/End: Original strand, 46682161 - 46682367
Alignment:
| Q |
14 |
aaggtcaatttagagaatggtatgtttgagcctattgaaaagggagaaaccaacgaagatgccctcaaaaggtaaatatatacaaaacatgtttcattat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46682161 |
aaggtcaatttagagaatggtatgtttgagcctatggaaaagggagaaaccaacgaagatgccctcaaaaggtaaatatatacaaaacatgtttcattat |
46682260 |
T |
|
| Q |
114 |
aattaatagacaattatgtgattaaatgactaaacatttgttgtaacctttgcaggtttgccaaaatactttctcaagagaggaggctacgagagttgaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| |||| |||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46682261 |
aattaatagacaattatgtgattaaatgactaaacatttgttttaatctttccaggtttgccaaaatactttctcaagagaggaggctccgagagttgaa |
46682360 |
T |
|
| Q |
214 |
atcccct |
220 |
Q |
| |
|
||||||| |
|
|
| T |
46682361 |
atcccct |
46682367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 126 - 220
Target Start/End: Complemental strand, 46655463 - 46655369
Alignment:
| Q |
126 |
attatgtgattaaatgactaaacatttgttgtaacctttgcaggtttgccaaaatactttctcaagagaggaggctacgagagttgaaatcccct |
220 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46655463 |
attatgcgattaaatgactaaacatttgttttaatctttgcaggtttgccaaaatactttctcaagagaggaggctacgagagttgaaatcccct |
46655369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 14 - 87
Target Start/End: Original strand, 46678170 - 46678243
Alignment:
| Q |
14 |
aaggtcaatttagagaatggtatgtttgagcctattgaaaagggagaaaccaacgaagatgccctcaaaaggta |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || || |||||| |||| || ||||||||||| |
|
|
| T |
46678170 |
aaggtcaatttagagaatggtatgtttgagcctattgaaaatggggagaccaaccaagaagctctcaaaaggta |
46678243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 164 - 220
Target Start/End: Original strand, 46678365 - 46678421
Alignment:
| Q |
164 |
tgcaggtttgccaaaatactttctcaagagaggaggctacgagagttgaaatcccct |
220 |
Q |
| |
|
||||||||||| |||||||| || |||||||||| ||| ||||| |||| ||||||| |
|
|
| T |
46678365 |
tgcaggtttgcaaaaatactatcacaagagaggaagcttcgagaattgacatcccct |
46678421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University