View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19618_high_11 (Length: 450)
Name: NF19618_high_11
Description: NF19618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19618_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 362; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 362; E-Value: 0
Query Start/End: Original strand, 16 - 432
Target Start/End: Complemental strand, 36004562 - 36004152
Alignment:
| Q |
16 |
atgttgtacgtaatcataaaaatattgggtgagccattgaacactctagacacagtcccacccaatccgcaaactaatcgttgttcccattggcattgat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
36004562 |
atgttgtacgtaatcataaaaatattgggtgagccattgaaaactctagacacagtcccacccaatccgcaaactaatcgtgtttcccatcggcattgat |
36004463 |
T |
 |
| Q |
116 |
aattgttatccactcatttagcagaaaccagcaaatagaatcaaaccaaaaatggagacaacactttccctttcttcttcttcttcaattctccctagga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36004462 |
aattgttatccactcatttagcagaaacaagcaaatagaatcaaaccaaaaatggagacaacactttccctttcttcttcttcttcgattctccctagga |
36004363 |
T |
 |
| Q |
216 |
ctaggcttccaatctcttcatcctattccaacttatccttctcagcttctaattctaacactacatcacttctcttgaagaaagccagaaccagaaccag |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36004362 |
ctaggcttccaatctcttcatcctattccaacttatccttctcagcttccaattctaacactacatcacttctcttgaagaaagccagaaccagaacc-- |
36004265 |
T |
 |
| Q |
316 |
aaccagaagcacaaagcgttttacttgcaacgccttctttggattaggcgtgcccgagcttgttgttattgccggagttgctgctcttgttttcggtccc |
415 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36004264 |
----agaagcacaaagcgttttacttgcaacgccttctttggattaggcgtgcccgagcttgttgttattgccggagttgctgctcttgttttcggtccc |
36004169 |
T |
 |
| Q |
416 |
aagaaattgcccgaagt |
432 |
Q |
| |
|
||||||||||| ||||| |
|
|
| T |
36004168 |
aagaaattgcctgaagt |
36004152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University